Fly Stocks

Drosophila were raised on standard culture media at 25^oC. Strains used in these studies include OregonR, CantonS, w¹¹¹⁸, stai^rdtp, PBac{5HPw⁺} stai^B200, Df(2L) BSC5, Df(2L) ED384, Df(2L) ED385, Df(2L) BSC239, Df(2L) Exel6015, Khc²⁰, w¹¹¹⁸; CyO P{FRT(w⁺) Tub-PBac\T} 2/wg^Sp-1, tub-Gal4, and tubulin-staiB2 (gift of Pernille Rorth, IMCB, Singapore), tubulin-STMN1. PBac{5HPw⁺} stai^B200 is a stai mutant Drosophila strain obtained from the Bloomington Drosophila Stock Center and is derived from a progenitor line containing a 5’ half-P construct generated by Brian Ring and Dan Garza [24].

The piggyBac insertion in PBac{5HPw⁺} stai^B200 was precisely excised by crossing PBac{5HPw⁺} stai^B200/CyO against w¹¹¹⁸; CyO P{FRT(w⁺) Tub-PBac\T} 2/wg^Sp-1 and generating individual balanced stocks that were determined by eye color to have the piggyBac transposon excised. The nature of the excision for each was confirmed by PCR across the original insertion site and subsequent sequence analysis.

The stai^B200 Khc²⁰ chromosome was generated by meiotic recombination, and balanced over CyO Act GFP. Recombinant stai^B200 Khc²⁰ chromosomes were identified by outcrossing each potential recombinant line against w¹¹¹⁸ and following the inheritance of the mini w⁺, associated with stai^B200, in straight-winged progeny. The presence of Khc²⁰ was inferred by the absence of straight-winged flies in each recombinant stock, and confirmed by lethality in heterozygous combination with Df(2R) Jp8.

PCR Amplification and Sequencing of the stai Genomic Region

Genomic DNA was isolated from homozygous third instar stai^rdtp larvae according to standard protocol [25]. The coding region of the stai gene was amplified in four separate PCR reactions using HotStar HiFidelity DNA Polymerase (Qiagen, Valencia, CA) according to manufacturer’s recommended protocol. PCR primers used were stai1 5’-GCTAATCAAACGTGCTTAAAGCGAATT-3’, stai2 5’-GTTTCGAATCAGTTGAGTAAGAATATA-3, stai3 5’-GCATTACTCGAATCAATCAAGTTCAA-3’, stai4 5’-GTATCCACATTCGCTGTAGATGGATCT-3’, stai5 5’-GCCAGCAATCAAACACTTCAACAATGA-3’, stai6 5’-GCATTTTATCTGCTTCATGCATAGTTG-3’, stai7 5’-CGATGTAACACTAAATTCGTATTGTTT-3’, and stai8 5’-CTCGCTCAGCGGTATCTTGAGACTTTG-3’. All PCR products were resolved by agarose gel electrophoresis and purified using the QIAquick Gel Extraction Kit (Qiagen). PCR products were sequenced by Eurofins MWG Operon (Huntsville, AL) using the primers designed to PCR amplify the stai locus, in addition to the oligonucleotides stai9 5’-GCTACCAAACCTATTGCATCCCATAGT-3’ and stai10 5’-GACTGGACTAGCAAACTGGTTAACATT-3’.

qRT-PCR

mRNA purified from third instar larvae using the Oligotext Direct mRNA Mini Kit (Qiagen) was used to synthesize cDNA with the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA). RT-PCR was performed with the SYBR Green PCR Master Mix (Applied Biosystems) on an ABI 7300 Real Time PCR System (Applied Biosystems). In order to distinguish between stai transcripts with different transcriptional start sites, stai message was quantified with 'forward' oligonucleotides complementary to coding sequence within exon 2 (5’- GGTGAACAACACTGTTGATACTG -3’) shared by staiB isoforms, and sequence downstream of the copia insertion site in stai^rdtp within exon 1’ (5’- GATTAGTACGCGACTCGGTGA -3’) shared by staiA isoforms, in separate amplifications with a ‘reverse’ oligonucleotide complementary to sequence in exon 3 (5’- CTCAATCTCCTCGACGCTAAC -3’), shared by all stai isoforms. Results were normalized against the signal from the GAPDH gene product (5'-AATTAAGGCCAAGGTTCAGGA-3', 5'-ACCAAGAGATCAGCTTCACGA-3'). All RT-PCR experiments were repeated five times for each genotype, and analyzed and quantified using the comparative C_T method (ΔΔC_T method). The results are presented as mean ± standard deviation (SD). Significance was determined by ANOVA of ΔC_T values [26,27].

Quantification of the Posterior Paralysis 'Tail-Flip' Phenotype

The posterior paralysis phenotype of late third instar larvae was analyzed as described previously [28]. Briefly, third instar larvae of each genotype were collected, rinsed in ddH₂O and placed in 60 x 15 mm culture dishes, and the crawling behavior of each larva observed. A minimum of one hundred larvae was analyzed for each genotype. The severity of the posterior paralysis phenotype was scored and quantified using the following criteria; larvae were determined to exhibit a robust tail-flip if the tail was raised greater than 40^o above horizontal when crawling; a mild tail-flip if the tail was raised less than 40^o above horizontal when crawling, and no-tail flip if the larva exhibited a normal crawling behavior. The crawling behavior of third instar larvae was recorded with a Canon PowerShot G10 coupled to an Olympus SZ61 stereomicroscope and the resultant movies processed in iMovie and QuickTime Pro.

Larval Preparation, Immunohistochemistry and Microscopy

Immunostaining of larvae was performed according to standard protocol [29]. In brief, wandering third instar larvae were dissected in Ca²⁺ free HL3.1 buffer [30] and fixed for 30 minutes in freshly prepared 4% paraformaldehyde in PBS, pH 7.4. The larvae were washed and permeabilized in PBT (PBS + 0.2% Triton X-100), blocked in 1% BSA in PBT, and incubated overnight at 4^oC with primary antibody in PBT. Following removal of the primary antibody, the larvae were washed in PBT and incubated for 2 hours at room temperature with fluorescently conjugated secondary antibody in PBT. Following removal of the secondary antibody and PBT washes, larval preparations were mounted on glass slides in Vectashield mounting medium (Vector Laboratories, Burlingame, CA). Antibodies were used at the following concentrations; mouse monoclonal anti-Drosophila cysteine string protein (DCSP-2 mAb 6D6) 1:200, anti-Futsch (mAb 22c10) 1:5 (Developmental Studies Hybridoma Bank, IA), anti-α-tubulin (mAb DM1A) 1:1000 (Sigma, St. Louis, MO), anti-acetylated α-tubulin (mAb 611B1) 1:250 (Sigma), Alexa Fluor 488 goat anti-mouse 1:250, and Alexa Fluor 568 goat anti-mouse 1:250 (Invitrogen). Nuclei were visualized by co-staining with Syto24 (Invitrogen) at a 1:1000 dilution during secondary antibody treatment.

Confocal Imaging and Analysis

All images were acquired on a Zeiss LSM-710 laser scanning confocal microscope. Imaging parameters, including signal gain, for a given experimental treatment were set such that the brightest treatment group produced images that were non-saturating. All imaging parameters were kept constant across a given experimental treatment.

Images of segmental nerve axons represent three-dimensional maximum intensity projections of serial stacks, ~10.4-14.2 µm thickness, acquired from the four to six medial segmental nerves spanning abdominal segments A4-A6. Disruptions in axonal transport were quantified from maximal intensity projection images of segmental nerve axons as they passed through abdominal segments A2 and A4 using the threshold and particle analysis functions in ImageJ (ver 1.47k) with a size detection minimum of 0.5 µm². Results are reported as number of CSP accumulations/50 µm segmental nerve axon. Futsch and acetylated α-tubulin staining intensity was quantified using the histogram function of the Zen 2010 image analysis software package that reports a distribution of pixel intensities, as well as average pixel intensity, in a selected region of interest of an image. A lower threshold for the histogram analysis was applied to all images analyzed. Statistical analysis across the genotypes analyzed was performed using ANOVA of average pixel intensity of all segments analyzed within each experimental group, followed by Fisher’s LSD post hoc analysis.

Images of larval muscle represent three-dimensional maximum intensity projections of serial stacks, ~14.8-16.2 µm thickness, through muscle 6 at abdominal segment A4. Perinuclear MT density was quantified with ImageJ 1.44o by measuring the ratio of tubulin positive: negative staining signal in an area that extends 5 µm around the nucleus. Average perinuclear MT density was determined for each genotype by measuring MT density surrounding at least twenty nuclei, recorded from six larvae. The average perinuclear MT density for each genotype was normalized against wildtype.

Analysis of Lifespan and Bang-Sensitive Phenotypes

The life span of male Drosophila was measured at 25^oC. Females were excluded from the life span analysis due to observed sex differences regarding the effect of dietary restriction on lifespan [31]. Adult flies were collected 24-hours post eclosion and maintained in standard culture vials (25 mm x 95 mm) with a maximum of 10 flies per vial. Flies were counted daily and transferred to fresh vials every other day. A minimum of one hundred flies per genotype was analyzed. The mean lifespan for each genotype was calculated by averaging individual lifespans for flies within a cohort. Significance was determined by ANOVA followed by Fisher’s and Scheffe’s post hoc analysis.

The bang-sensitive phenotype was quantified by the methodology of Ganetzky and Wu [32]. Briefly, male Drosophila of each genotype were aged at 25^oC. Forty-eight hours prior to testing, the aged flies were CO₂ anaesthetized and a maximum of five flies were placed into fresh vials. The flies were mechanically stimulated by vortexing at full-speed in culture vials for 10 seconds and the number of flies exhibiting paralysis counted. The penetrance and severity of the bang-sensitive phenotype was quantified by testing a minimum of fifty aged adult male flies of each genotype for bang sensitivity following mechanical stimulation at 1, 7, 14, 21, 42 and 56 days post eclosion. In addition, the average time period required for recovery from the paralysis was also quantified for each fly by measuring the time from the end of the vortex period until the paralyzed flies regained the ability to stand and take their first steps.

Western Blot Analysis

Five third instar larvae of each genotype were homogenized in 100 µl of 2x NuPAGE LDS Sample Buffer (Invitrogen), incubated at 80^oC for 10 minutes, and centrifuged at 16,000 x g for 5 minutes. The supernatant was decanted into new microcentrifuge tubes and the protein concentrations determined using the RC-DC Protein Assay (Bio-Rad, Hercules, CA). For each genotype, 25 µg of protein was resolved on NuPAGE 4-12% Bis-Tris Polyacrylamide Gels and transferred to nitrocellulose membrane (0.45 µm) (Bio-Rad) at 300 mA for 120 minutes in Tris-Glycine transfer buffer (25 mM Tris-Base, 190 mM Glycine). The efficiency of transfer was confirmed by Ponceau S stain (0.1% w/v Ponceau S, 5% v/v acetic acid). The blot was incubated in blocking buffer (5% Carnation dry milk, 50 mM Tris, 150 mM NaCl, 0.5% Tween 20) for one hour at room temperature prior to overnight incubation with primary antibody in antibody dilution buffer (1% Carnation dry milk, 50 mM Tris, 150 mM NaCl, 0.5% Tween 20) at 4^oC. Following washes in wash buffer (0.2% Carnation dry milk, 50 mM Tris, 150 mM NaCl, 0.05% Tween 20), the blot was incubated with secondary antibody for two hours at room temperature. The SuperSignal Chemiluminescent Substrate Kit for Western Blotting (Pierce, Rockford, IL) was used for detection and the blot was exposed to X-ray film and developed for signal visualization. Primary antibodies included anti-α-tubulin 1:5,000 (DM1Α T-9026, Sigma), anti-acetylated α-tubulin 1:5,000 (T-6793, Sigma), anti-actin 1:10,000 (mAb1501, Chemicon), anti-GAPDH (IMG-3073, Imgenex Corp, San Diego, CA) anti-Kinesin heavy chain 1:5,000 (AKIN01, Cytoskeleton, Denver, CO) and anti-kinesin light chain 1:1,000. Secondary antibodies included HRP conjugated Goat anti-Mouse IgG (81-6520) and HRP conjugated Goat anti-Rabbit IgG (65-6120) used at 1:20,000 dilutions (Zymed Laboratories, Invitrogen Immunodetection). Western blots were quantified and data corrected for load using anti-GAPDH antibody as a loading control. Quantitation was performed using a BioRad ChemiDoc XRS+ chemiluminescence detection system with a 16-bit CCD camera and ImageJ.

Generation of Antisera against Drosophila Kinesin Light Chain

Rabbit polyclonal antisera was produced against recombinant Drosophila kinesin light chain protein following PCR amplification of the Klc gene from cDNA clone NM_079325.3 with primers Klc(Xho1) 5'-ATCCGAGCTCGAGACGCAAATGTCGCAG-3' and Klc(Kpn1) 5'-CGAATTCCATGGTACCTTATGGTTTCGC-3'. The resultant PCR product was cut with Xho1 and Kpn1 and subcloned into the Xho1/Kpn1 site of the pRSET-A plasmid to generate pRSET-A-Klc. pRSET-A-Klc was sequenced to confirm a complete Klc open reading frame, transformed into BL21(DE3) pLysS, and expression of the His-tagged Klc protein was induced in a 100 ml culture at OD₆₀₀=0.5 with IPTG to a final concentration of 1 mM. The cells were harvested four hours post induction and the recombinant Klc protein was purified using nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (Qiagen), electrophoretically isolated and used to raise antisera in rabbits (Covance Research Products, Denver, PA). The specificity of the Klc antibody was confirmed by western blot against total protein extract isolated from third instar larvae. In wildtype Drosophila, the antibody recognized a single band of approximately 60 kDa, and a reduction in the intensity of the signal from this 60 kDa band was observed in protein from a heterozygous strain harboring the chromosomal deletion Df(3L) 8ex94 that removes the Klc gene [33].

Generation of Transgenic Drosophila for Ubiquitous Expression of Human Stathmin

PCR was used to introduce a 5' Not1 and 3' Xho1 restriction site flanking the full-length open reading frame of the cDNA clone encoding human stathmin 1 (STMN1) transcript variant 1 (Accession No. NM_203401.1, gift of Lynne Cassimeris, Lehigh University, PA) with PCR primers hstai(Not1) 5'-GAGCGGCCGCATGGCTTCTTCTGATATC-3' and hstai(Xho1) 5'-GACTCGAGTTAGTCAGCTTCAGTCTC-3'. The PCR product was cut with Not1 and Xho1 and directionally subcloned into the Not1/Xho1 site of the pCaSpeR-tub plasmid (gift of Pernille Rorth, IMCB, Singapore) to generate pCaSpeR-tub-STMN1. The pCaSpeR-STMN1 rescue construct was sequenced to verify a complete STMN1 open reading frame. Standard germline transformation techniques [34] were employed to generate multiple independent transgenic lines that were mapped to identify third chromosome insertion lines used to generate homozygous stocks.

Isolation and Molecular Characterization of stathmin Mutant Alleles

The redtape (rdtp) mutation was isolated in a genetic screen for recessive third chromosome P-element induced mutations that disrupt axonal transport in Drosophila melanogaster (unpublished data). The basis for the mutagenic screen was a posterior paralysis of third instar larvae, observed as a 'tail-flip', previously described for mutations in genes that encode proteins required for axonal transport [28,29,35–38]. Initial analysis of the rdtp mutation led to the discovery that the posterior paralysis observed in homozygous mutant larvae was due to a second chromosome mutation and not the P-element insertion. The rdtp mutation was subsequently mapped to cytological region 26B5-26C1 on the left arm of the second chromosome by its failure to complement Df(2L) BSC5, Df(2L) ED384, Df(2L) ED385, Df(2L) Exel6015 and Df(2L) BSC239. Further analysis identified PBac{5HPw⁺} stai^B200, obtained from the Bloomington Drosophila Stock Center, as a non-complementing gene mutation. Heteroallelic combination of rdtp and stai^B200 recapitulated the larval ‘tail flip’ phenotype originally observed in rdtp homozygotes, indicating that rdtp is a mutant allele of the stai gene. The rdtp mutation was subsequently renamed stai^rdtp.

PCR amplification of the stai gene from homozygous second instar stai^rdtp larvae generated an ~5.6 kb PCR product for exon 1', larger than the predicted 510 bp PCR product observed in wildtype (Figure 1B). The 5.6 kb PCR product was sequenced and found to encode a copia retrotransposon, a member of a broad class of natural genetic elements characterized by long direct terminal repeats [39]. Spontaneous copia-induced mutations have been previously reported for many genes in Drosophila [40–44]. The copia element in stai^rdtp is inserted in the open reading frame of the stai gene (Figure 1A). The non-complementing stai^B200 mutation is the result of a piggyBac transposon insertion in the 2.8 kb intron separating exons 1’ and 2’ of the stai gene (Figure 1A), 1337bp downstream of exon1’ and 1469bp upstream of exon 2’ (genome sequence position 2L:6,111,561 – FlyBase version FB2013_01, released January 23^rd, 2013).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Identification of Mutations in the stathmin (stai) Locus.

(A) Genomic structure of the Drosophila stai locus and the positions of the mutagenic copia retrotransposon stai^rdtp and the piggyBac element stai^B200. Exons are boxed, noncoding portions of exons are white, exons 3, 4, 5, shared by all stai proteins, are light grey (after Lachkar et al, 2010). Transcripts encoding staiA isoforms include exons 1 and 2 with alternative splicing that either includes (staiA1) or excludes (staiA2) exon 6. Transcripts encoding staiB isoforms include exons 1’and 2’ with alternative splicing that either includes (staiB1) or excludes (staiB2) exon 6. The copia retrotransposon stai^rdtp is inserted in the open reading frame of the stai gene in exon 1', ten base pairs downstream of the translational start site used to produce nervous system enriched staiB encoding transcripts. The piggyBac element PBac{5HPw⁺}stai^B200 is inserted in the 2.8 kb intron separating exons 1’ and 2’, 1.3kb downstream of the splice junction of exon 1’. (B) The copia insertion in the stai gene was identified by PCR amplification across the open reading frame of stai exon 1’ that resulted in an unexpectedly large 5.6 kb product from genomic DNA isolated from stai^rdtp homozygous larvae. The black arrowheads in Figure 1A represent the relative position of PCR primers used. (C) qRT-PCR of staiA and staiB mRNA derived from third instar larvae is shown. The expression of staiA and staiB is significantly reduced in all stai mutant genotypes analyzed compared to wild type expression levels (P<0.01). The red and blue arrowheads in Figure 1A represent the relative position of primers used for qRT-PCR of staiA and staiB message. Results are normalized against the expression of the GAPDH gene product and are presented as mean ± SD.

https://doi.org/10.1371/journal.pone.0068324.g001

Expression of stai is Reduced in stai^rdtp and stai^B200 Larvae

We used qRT-PCR to determine if the copia insertion in stai^rdtp and the piggyBac insertion in stai^B200 altered the expression level of the stai gene in third instar larvae. Amplification with primer pairs specific for detection of staiA and staiB mRNA isoforms revealed significantly reduced levels of both transcripts in homozygous stai^rdtp third instar larvae (P<0.01) (Figure 1C). Transcripts encoding staiA isoforms were more strongly affected, reduced to as little as 12.0 ± 1.0% (mean ± SD) of wild type levels, compared to staiB encoding transcripts, which were reduced to 41.0 ± 4.0% of wild type levels (Figure 1C). As expected, heterozygous combination of stai^rdtp with Df(2L) Exel6015, a 170 kb chromosomal deletion that removes 14 genes including stai, reduces the abundance of staiA and staiB derived transcripts to 4.0 ± 1.0% and 15.0 ± 5.0% respectively, approximately 50% of the levels observed in stai^rdtp homozygous larvae (Figure 1C). The level of staiB message is also reduced in homozygous stai^B200 mutant third instar larvae, to 1.0 ± 1.0% of wildtype (P<0.0001) (Figure 1C). The levels of staiA encoding transcript in homozygous stai^B200 larvae and message encoding both staiA and staiB isoforms in stai^B200/Df(2L) Exel6015 larvae are reduced to undetectable levels (Figure 1C).

Lethal Phase Analysis of stai Mutants

Despite the dramatic reduction in stai message, the stai^B200 allele causes semi-lethality, with approximately 40% of the expected homozygous progeny from a heterozygous cross surviving to the adult stage (n=1900), suggesting that stai function is not essential for adult viability. These results are supported by the previous observation that stai null Drosophila are adult viable [45]. Unexpectedly, homozygous stai^rdtp larvae were inviable past the third instar stage with no homozygous adults recovered among the progeny of a heterozygous cross (n=1000). This was confounding given that greater stai message was detected in homozygous stai^rdtp larvae than stai^B200 larvae (Figure 1C) and that stai null Drosophila are reported to be adult viable [45]. The mutagenic copia insertion in stai^rdtp, however, is inserted in exon 1' of the stai open reading frame used to produce neuronal staiB splice variants. We considered the possibility that the copia sequence was incorporated in the staiB message produced by stai^rdtp mutant larvae, resulting in a dominant negative protein. However, a significant number of viable adults were observed when the stai^rdtp chromosome was placed in heterozygous combination with stai^B200 or Df(2L) Exel6015. Therefore, it is likely that an additional mutation responsible for the homozygous lethality exists on the stai^rdtp chromosome. Given the likely presence of a second, lethal mutation on the stai^rdtp chromosome, and the observation by others that copia-induced gene mutations are subject to the action of suppressor or enhancer alleles mapping to other loci, resulting in complex phenotypes [46,47], the focus of this study is the stai^B200 mutant allele and the use of the stai^rdtp chromosome is limited to heterozygous analysis or in heteroallelic combination with stai^B200 and Df(2L) Exel6015.

Loss of stai Function Results in a Larval Posterior Paralytic Phenotype

Homozygous stai^rdtp and stai^B200 third instar larvae exhibited phenotypes characteristic of mutants with impaired axonal transport. Although stai mutant larvae were of comparable size to wild type larvae, their posterior regions were often weakly tapered and reduced in diameter as reported in other axonal transport mutants (data not shown) [48]. When homozygous stai^rdtp and stai^B200 larvae crawled along the surface of a substrate, they exhibited a crawling behavior in which the posterior body segments sharply flipped upward after each peristaltic wave of muscle contraction during the crawling cycle (compare Figure 2A with 2B and 2C, Movies S1-S3). Heterozygous combination of stai^B200 with stai^rdtp recapitulated the tail-flip phenotype (Movie S4). The larval posterior-paralysis or tail-flip phenotype is a hallmark of defective axonal transport in Drosophila and has been previously described for mutations in genes that encode components of MT motor protein complexes, such as kinesin and cytoplasmic dynein, as well as motor accessory proteins [28,29,33,35–37]. The phenotype is thought to result from a dorsal-ventral gradient in posterior muscle paralysis that causes an imbalance in contraction of the larval body wall muscles [29]. Interestingly, stai null third instar larvae also exhibited a posterior paralysis phenotype (gift of Pernille Rorth, IMCB, Singapore) (Movie S5).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. Loss of stai Function Results in Defects in Fast Axonal Transport.

Mutations in stai result in phenotypes consistent with axonal transport defects. (A) Wildtype third instar larvae maintain a flat body posture when crawling. In contrast, homozygous stai^B200 larvae (B) and stai^rdtp larvae (C) exhibit a posterior paralysis “tail flip” phenotype common for Drosophila mutants defective in axonal transport (Movies S1-S3). The tail-flip phenotype is also observed in heterozygous stai^B200/stai^rdtp larvae (Movie S4). Confocal micrographs of sections of segmental nerve from wildtype (D), stai^B200/+ heterozygous (E) and stai^B200 homozygous (F) third instar larvae stained with antibody against synaptic vesicle protein cysteine string protein (CSP). (D) The axons of wild type animals showed faint, punctate staining for CSP uniformly throughout the axons within the compound nerve bundle. (E) Although heterozygous stai^B200 larvae showed no obvious sluggishness or tail-flip phenotype when they crawled, mild accumulations of CSP were observed in some segmental nerve axons. (F) In contrast, homozygous mutant stai^B200 larvae exhibit abundant accumulations of CSP throughout the segmental nerve, confirming a disruption in axonal transport. (G) When stai^B200 is placed in heterozygous combination with Df(2L) Exel6015, a chromosomal deletion that spans the stai locus, there is an enhancement in the abundance of axonal accumulation of CSP. (H) The severity of axonal transport defects was quantified by averaging the number of accumulations of CSP immunopositive anterograde and retrograde membranous axonal cargos observed in the segmental nerve axons of stai deficient third instar larvae. To determine if there was an anterior-to-posterior gradient in the severity of axonal transport defects, regions of segmental nerve axons were analyzed as they passed through abdominal segment A2 (light grey bars) and abdominal segment A4 (dark grey bars). Data is also presented as total number of accumulations observed in both abdominal regions (black bars). The only significant regional difference observed in the abundance of axonal clogs in segmental nerve axons between abdominal segment A2 and A4 was in the axons examined from stai^B200/Df(2L) Exel6015 larvae (p<0.0001). Wild type larvae exhibited 0.57 ± 1.21 axonal clogs/50 µm segmental nerve axon in all axons examined. Homozygous stai^B200 larvae averaged 13.55 ± 5.56 axonal clogs/50 µm segmental nerve axon (p<0.0001). The average number of axonal clogs observed in the segmental nerve axons of stai^B200/Df(2L) Exel6015 larvae was 15.10 ± 6.07 axonal clogs/50 µm segmental nerve axon. In panels A-C, the scale bar = 1mm. In panels D-G, the scale bar = 10 µm.

https://doi.org/10.1371/journal.pone.0068324.g002

We quantified the posterior paralysis and tail-flip phenotype of stai mutant larvae as described in the Materials and Methods. The posterior paralytic phenotype was incompletely penetrant, with 76.7% (n=92/120) of stai^B200 third instar larvae examined exhibiting a tail-flip (Table S1). Of the stai^B200 larvae exhibiting a posterior paralysis, 69.6% (n=64/92) had a robust tail-flip while 30.4% (n=28/92) had a mild tail-flip. The posterior paralysis phenotype was not observed in heterozygous stai^B200/+ larvae (n=0/130) or larvae heterozygous for the chromosomal deletion Df(2L) Exel6015 (n=0/120). Heterozygous combination of the stai^B200 allele with Df(2L) Exel6015 increased the penetrance of third instar larvae exhibiting the posterior paralysis phenotype to 89.1% (n=90/101), with 75.6% (n=68/90) exhibiting a robust tail-flip and 24.4% (n=22/90) a mild tail-flip (Table S1). Thus, despite having almost undetectable levels of stai expression, as quantified by qRT-PCR (Figure 1C), the stai^B200 allele maintains some residual stai function and behaves like a strong hypomorphic mutation.

stai Deficient Axons Exhibit Defects in Axonal Transport

Mutations in genes required for axonal transport not only cause a similar posterior paralysis and tail-flip phenotype in third instar larvae, but they also result in the accumulation of anterograde and retrograde membranous axonal cargo in the segmental nerves of these animals [29]. To determine if the posterior paralysis phenotype observed in stai mutant larvae resulted from impaired axonal transport, the distribution of cysteine string protein (CSP) in the axonal compartment was assayed by immunohistochemistry. CSP is a synaptic vesicle protein transported in a microtubule-dependent manner within the axons of larval segmental nerves [49,50]. In wildtype segmental nerve axons, CSP exhibits a uniform, punctate staining pattern throughout the axoplasm (Figure 2D). Heterozygous stai^B200/+ larvae exhibited an average of 1.64 ± 2.95 (mean ± SD) CSP accumulations/50 µm segmental nerve axon examined (n=71 axon segments examined, p>0.05) (arrowheads Figure 2E, 2H). stai^B200/+ larvae exhibit a normal crawling behavior and the absence of a posterior paralysis phenotype, indicating axonal transport is not significantly compromised in peripheral nerve axons. In contrast, homozygous stai^B200 third instar larvae exhibited 13.55 ± 5.56 aggregations of CSP/50 µm segmental nerve axon (n=52, p<0.0001, Figure 2F, 2H), consistent with an impairment in axonal transport. The CSP aggregations were not significantly enhanced in stai^B200/Df(2L) Exel6015 larvae (15.10 ± 6.07 CSP accumulations/50 µm segmental nerve axon, n=57, p=0.06, Figure 2G, 2H). These results confirm that stai activity is required for efficient axonal transport in peripheral nerves.

To determine if there was an anterior to posterior gradient in the phenotypic severity of CSP aggregations in segmental nerve axons of stai mutant larvae, we quantified and compared the extent of axonal transport defects in regions of segmental nerve axons that passed through the more anterior abdominal segment A2 and the posterior abdominal segment A4 (Figure 2H). The only regional difference in the abundance of axonal clogs in segmental nerve axons was observed in axons from stai^B200/Df(2L) Exel6015 larvae (p<0.0001).

Adult Viable stai Mutants Have Reduced Lifespans

Our observations indicate that Drosophila can tolerate significant reductions in stai levels. Despite a large percentage of third instar larvae exhibiting a posterior paralysis due to impairment of axonal transport, a significant percentage of stai mutant animals manage to survive to the adult stage but exhibit significant reductions in average adult lifespan at 25^oC (Figure 3). The stai^B200/+ heterozygote has an average adult lifespan of 81.0 ± 1.2 days, not significantly different from the 77.5 ± 1.6 days observed in the wildtype (P≥0.05) (Figure 3A, B) or the 80.2 ± 1.6 days in Df(2L) Exel6015/+ adults (P≥0.05) (data not shown). In contrast, a significant reduction in average adult lifespan was observed for stai^B200 adults, averaging 46.6 ± 2.3 days (P<0.0001) (Figure 3A, B). The average adult lifespan was reduced even further, to 34.8 ± 2.3 days (P<0.0001) in stai^B200/Df(2L) Exel6015 adult males (Figure 3A, 3B).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. Loss of stai Function Reduces Adult Drosophila Lifespan.

The lifespan of adult male Drosophila of seven different genotypes were measured at 25^oC. A minimum of one hundred flies for each genotype were analyzed and the number of surviving flies were counted daily and survivorship curves generated (A). Adult wildtype Drosophila had an average lifespan of 77.5 ± 1.6 days (mean ± SE), not significantly different from the average lifespan of 81.0 ± 1.2 days observed in stai^B200/+ heterozygous adults (p≥0.05) or the 80.2 ± 1.6 day average lifespan of Df(2L) Exel6015/+ adults (p≥0.05) (data not shown). In contrast, the average lifespan of homozygous stai^B200 adults was 46.6 ± 2.3 days, significantly less than the average lifespan of wildtype, and heterozygous stai^B200/+ and Df(2L) Exel6015/+ adults (p<0.001). Adult males of the genotype stai^B200/Df(2L) Exel6015 had an even shorter average adult lifespan of 34.8 ± 2.3 days, significantly less than stai^B200 homozygous adult males (p<0.001). Introduction of an exogenous copy of a ubiquitously expressed transgene encoding the neuronal specific staiB2 isoform, tub-staiB2, rescued the adult average lifespan of both stai^B200 homozygous adults to 68.5 ± 2.3 days (p<0.001) and stai^B200/Df(2L) Exel6015 adults to 64.8 ± 2.3 days (p<0.001).

https://doi.org/10.1371/journal.pone.0068324.g003

Adult Viable stai Mutants Exhibit a Progressive Bang-Sensitive Seizure Phenotype

While performing the lifespan analysis on adult viable stai mutants, we observed they exhibit a temporary paralysis in response to the mechanical activity of being transferred to new food vials. This phenotype is similar to that observed in the "bang-sensitive" class of genes, mutant alleles of which cause neurological defects characterized by a paralysis or seizure in response to mechanical stimulation. Mutant alleles of a number of genes have been identified that exhibit a bang-sensitive phenotype including bang-sensitive (bas), bang-senseless (bss), technical knockout (tko), slam dance (sda) and easily shocked (eas). These genes are involved in diverse cellular processes including ion transport, Ca²⁺ release and mitochondrial metabolism [51,52]. Typically, the seizures become easier to trigger, and the subsequent paralysis increases in duration, with increasing age [53].

We quantified the response of stai mutant animals to mechanical stimulation by performing a bang-sensitive assay on adult male flies of different ages. We observed a normal response to, and recovery from, mechanical stimulation for all genotypes tested at 1, 7 and 14 days post eclosion (Tables S2 and S3). However, 20.9% of stai^B200 males tested at 21 days post eclosion (n=67) exhibited bang-sensitive paralysis with a mean recovery period of 48.6 ± 26.7 seconds (mean ± SD). During the bang-sensitive paralysis, flies laid motionless on the media at the bottom of the vial for periods ranging from 10 seconds to 3 minutes, depending on age. Upon recovery, flies exhibited a hyperactive phase, known as a recovery seizure, in which they vigorously flapped their wings and moved their legs for approximately 4-6 seconds, prior to righting themselves to a standing position and walking away. By 42 days, 75.8% of stai^B200 adults exhibited bang-sensitive paralysis, phenotype with an increase in the mean recovery period to 76.6 ± 41.4 seconds (n=62) (Movie S9). By 56 days, 91.7% of stai^B200 adults exhibited the bang-sensitive response with a mean recovery period of 145.4 ± 63.8 seconds (n=144).

Interestingly, the progressive bang-sensitive phenotype was also observed in heterozygous stai^B200/+ and stai^rdtp/+ adults, but with a delayed onset and a marked reduction in the recovery period following paralysis compared to stai^B200 adults (Tables S2 and S3). A bang-sensitive response to mechanical stimulation was first observed in heterozygous stai mutants at 42 days post eclosion where 25.2% of stai^B200/+ (n=111) and 18.0% of stai^rdtp/+ adults (n=50) exhibited the phenotype. The mean recovery period for stai^B200/+ adults was 55.7 ± 27.4 seconds and for stai^rdtp/+ adults was 55.4 ± 43.7 seconds. By 56 days post eclosion, the penetrance of the bang-sensitive phenotype had increased to 58.0% of stai^B200/+ and 52.9% of stai^rdtp/+ adults, with an increase in the average recovery period to 85.6 ± 43.6 seconds and 124.4 ± 71.8 seconds respectively (Tables S2 and S3). We conclude that viable adult stai mutants exhibit a progressive, age-dependent bang-sensitive phenotype to mechanical stimulation, reflective of compromised nervous system function.

Reversion and Rescue of stai Mutant Phenotypes

To demonstrate that all observed phenotypes are due to reduction in stai activity, we mobilized the piggyBac element in the stai^B200 allele to generate the precise excision allele stai^excision that restored the stai gene to its original structure and acted as a genotype matched control. All stai^B200 mutant phenotypes were reverted to wildtype in stai^excision animals. Homozygous stai^excision third instar larvae did not exhibit the posterior paralysis and tail-flip phenotype observed in stai^B200 larvae (n=0/120) (Table S1 and Movie S6). In addition, the aggregation of CSP immunoreactive vesicles in larval segmental nerves of stai^excision larvae was not significantly different than wildtype (0.91 ± 1.37 CSP accumulations/50 µm segmental nerve axon, n=70, p=0.68, compare Figure 4A and B Figure 4E). The average adult lifespan was also reverted to wildtype (74.6 ± 1.2 days) (P≥0.05) (Figure 3A, 3B). Finally, stai^excision adults did not exhibit the progressive bang-sensitive phenotype observed in stai mutant adults (Tables S2 and S3).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Reversion and Genetic Rescue of Fast Axonal Transport Defects in stai Deficient Axons.

Confocal micrographs of segmental nerves from (A) stai^B200 homozygous third instar larvae stained with antibodies against synaptic vesicle protein cysteine string protein (CSP). Note the abundant accumulation of CSP throughout the segmental nerve, indicative of a disruption in fast axonal transport. (B) In contrast, precise excision of the mutagenic piggyBac element PBac{5HPw⁺}, responsible for the loss of stai function in stai^B200, completely restores axonal transport and reverts the CSP staining pattern in the axon to the punctate, uniform distribution observed in wildtype axons (compare Figure 4B with Figure 2D) (Movie S6). (C) Introduction of a single copy of a ubiquitously expressed transgene encoding the neuronal specific staiB2 isoform, tub-staiB2, ameliorated the accumulation of CSP observed in the segmental nerves of stai deficient axons of stai^B200 larvae. (D) Introduction of a single copy of a ubiquitously expressed human transgene encoding the stai gene, tub-STMN1, also diminishes the accumulation of CSP in the segmental nerves of stai deficient axons of stai^B200 larvae, indicating the Drosophila and human stai proteins are functional orthologs. (E) The severity of axonal transport defects was quantified by averaging the number of accumulations of CSP immunopositive anterograde and retrograde membranous axonal cargos observed in the segmental nerve axons of stai deficient third instar larvae. Axonal transport defects are reverted to wildtype in the axons of stai^excision larvae that had 0.91 ± 1.37 CSP accumulations/50 µm segmental nerve axon (p<0.0001). Axonal transport defects are reduced in the segmental nerve axons of stai^B200 larvae expressing a single copy of the Drosophila rescue transgene tub-staiB2, 6.79 ± 6.43 axonal clogs/50 µm segmental nerve axon (p<0.0001), and the human transgene tub-STMN1, 3.92 ± 3.87 axonal clogs/50 µm segmental nerve axon (p<0.0001). Results are reported as the average number of axonal clogs (mean ± SD) per 50 µm segmental nerve axon. A small but significant increase in the severity of axonal clogs was observed in the segmental nerve axons of stai^B200 Khc²⁰/stai^B200 larvae (15.89 ± 3.80 CSP accumulations/50 µm segmental nerve axon, p<0.01) compared to stai^B200 third instar larvae. In panels A-D, the scale bar = 10 µm.

https://doi.org/10.1371/journal.pone.0068324.g004

Further, we were able to partially rescue all phenotypes observed in stai^B200 third instar larvae and viable adults with the ubiquitous ectopic expression of staiB2, a neuronal specific Drosophila stai isoform (tub-staiB2 - gift of Pernille Rorth, IMCB, Singapore) [54]. The severity of the posterior paralysis phenotype was greatly reduced in stai^B200; tub-staiB2/+ larvae compared to stai^B200 larvae (Table S1 and Movie S7). Immunohistological analysis revealed that the tub-staiB2 transgene significantly reduced the severity of the aberrant accumulation of CSP observed in segmental nerves of homozygous stai^B200 larvae (6.79 ± 6.43 CSP accumulations/50 µm segmental nerve axon, n=52, p<0.0001, compare Figure 4A and 4C Figure 4E). The tub-staiB2 transgene also delayed the onset and ameliorated the severity of the bang-sensitive phenotype exhibited by stai^B200 males from 75.8% to 5.8% (n=52) at 42 days post eclosion, while significantly reducing the mean recovery period to 39.7 ± 12.5 seconds from 76.6 ± 41.4 seconds (Tables S2 and S3). A single copy of the tub-staiB2 transgene also significantly increased average adult lifespan to 68.5 ± 2.3 days in stai^B200; tub-staiB2/+ adults, and to 64.8 ± 2.3 days in stai^B200/Df(2L) Exel6015; tub-staiB2/+ adults compared to the average lifespan of stai^B200 and stai^B200/Df(2L) Exel6015 adults (P<0.001) (Figure 3B). While the ectopic expression of staiB2 rescued the posterior paralysis and aberrant accumulation of CSP in segmental nerve axons of stai^rdtp homozygous larvae (data not shown), it did not rescue lethality, supporting the idea that the stai^rdtp chromosome carries a linked, lethal mutation.

Finally, we were also able to rescue the stai mutant phenotypes with the ubiquitous ectopic expression of the human stathmin gene, STMN1. A single copy of the tub-STMN1 transgene significantly reduced the aberrant accumulation of CSP in the segmental nerve axons of stai^B200 larvae (3.92 ± 3.87 CSP accumulations/50 µm segmental nerve axon, n=84, p<0.0001, compare Figure 4A and 4D Figure 4E). The tub-STMN1 transgene also reduced the percentage of stai^B200 larvae that exhibited a posterior paralysis phenotype from 76.7% (n=92/120) to 39.6% (n=44/111) (Table S1). In addition, the severity of the posterior paralysis phenotype was reduced to only 9.1% (n=4/44) of stai^B200; tub-STMN1 larvae that exhibited a robust tail-flip from 69.6% (n=64/92) of stai^B200 larvae (Table S1 Movie S8). These data support previous observations that the Drosophila and human stathmin proteins are functionally equivalent orthologs.

Although all observed stai mutant phenotypes could be rescued with both Drosophila staiB2 and human STMN1 transgenes, rescue was incomplete. This was likely due to the fact that the rescuing Drosophila staiB2 transgene expresses only one of the four known stai protein isoforms, which may have been insufficient for complete rescue. In addition, expression of both transgenes was under the control of the tubulin promoter that may not have provided the correct spatial and temporal expression of the transgenes.

Loss of stai Function Reduces Tubulin and Kinesin Heavy Chain Protein Levels

Since stai functions as a tubulin-binding protein and is known to regulate MT dynamics, we used western blot analysis to examine and quantify tubulin levels in total protein extracts isolated from stai mutant third instar larvae and adults. Levels of α-tubulin were significantly reduced in stai^B200/+ larvae compared with wild type controls (p<0.0001, Figure 5A, 5B). A more pronounced reduction in the levels of α-tubulin protein was observed in homozygous stai^B200 larvae (Figure 5A). Third instar stai^B200 larvae had levels of α-tubulin that were 15.0 ± 16.6% (mean ± SD) of that observed in wild type larvae (p<0.0001, Figure 5A, 5B). In order to assess the stability of polymerized MTs, we also assayed for levels of acetylated α-tubulin in stai mutant larvae. The levels of acetylated α-tubulin were also significantly reduced in stai^B200/+ mutant larvae (p<0.0001, Figure 5A, 5B), and more greatly reduced in homozygous stai^B200 mutant larvae to 36.9 ± 12.9% of the levels observed in wildtype (p<0.0001, Figure 5A, 5B). The posterior paralysis displayed by stai homozygotes is reminiscent of the ‘tail flip’ phenotype first described in Kinesin heavy chain (Khc) mutant larvae [29]. We therefore examined protein extracts from stai mutants to see if Khc levels were affected. We observed a significant reduction in the level of Khc, the force generating subunit of the MT motor protein kinesin-1, in stai mutant larvae (Figure 5A). Heterozygous stai^B200/+ larvae had levels of Khc protein that were 91.2 ± 4.2% of that observed in wildtype (p<0.05) whereas stai^B200 larvae had levels that were 53.8 ± 2.3% of wildtype (p<0.0001, Figure 5A, 5B). Collectively, these data suggest a general impairment of the MT-based transport system following loss of stai function in Drosophila.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. stai Mutants Have Reduced Levels of α-Tubulin, Acetylated α-Tubulin, and Kinesin Heavy Chain Protein.

(A) Representative western blots of total protein extracted from stai mutant third instar larvae. Heterozygous stai/+ mutant larvae exhibit mild reductions in the levels of α-tubulin and acetylated α-tubulin compared with wild type larvae. Homozygous stai mutant larvae have dramatic reductions in the levels of α-tubulin, acetylated α-tubulin and the heavy chain subunit of the microtubule motor protein kinesin compared to wildtype. Df(2L) BSC239 represents a second chromosomal deficiency that excludes the stai gene. GAPDH is used as a loading control. (B) Quantification of western blots of total protein extracts isolated from third instar larvae probed with antibodies against α-tubulin (mAB DM1A), acetylated α-tubulin (mAB 611B1), and kinesin heavy chain (AKIN01). Quantification was performed as described in the Materials and Methods. Results are normalized against wildtype and presented as mean ± S.D. Statistical comparison reveals that the levels of α-tubulin, acetylated α-tubulin, and kinesin heavy chain proteins for all genotypes examined differ significantly from wildtype (p<0.001), with the exception of levels of acetylated α-tubulin in stai^rdtp/+ larvae (**p<0.01) and kinesin heavy chain in stai^B200/+ (*p<0.05). (C) Western blot analysis of total protein extracted from stai mutant adult Drosophila aged 1 day and 21 days post eclosion. The levels of α-tubulin, and conventional kinesin motor heavy and light chain subunits are present at equal levels in wildtype, stai^B200/+, stai^B200 and stai^B200; tub-staiB2 adults 1 day post eclosion. At 21 days post eclosion, the age we observe stai^B200 adults exhibiting a bang-sensitive response to mechanical stimulation, the levels of α-tubulin, and conventional kinesin motor heavy and light chain subunits are noticeably reduced. Introduction of an exogenous copy of the rescuing transgene tub-staiB2, not only increases the levels of α-tubulin, but also increases levels of the conventional kinesin motor heavy and light chain subunits.

https://doi.org/10.1371/journal.pone.0068324.g005

Given the observed effect of loss of stai function on the levels of α-tubulin, acetylated α-tubulin and Khc protein in third instar larvae (Figure 5A), and the observation that ectopic expression of staiB2 rescued the shortened lifespan of stai^B200 adults (Figure 3A), we analyzed the levels of α-tubulin and kinesin-1 motor components in adult stai mutant animals at 1 day and 21 days post-eclosion (Figure 5C). These ages were chosen because they corresponded to the age at which a bang-sensitive response to mechanical stimulation was first observed in stai deficient animals (Table S2). At 1 day post-eclosion, the levels of α-tubulin, Khc and Kinesin light chain (Klc) subunits were equivalent across all genotypes analyzed (Figure 5C). However, by 21 days post-eclosion, there was a marked reduction in the levels of α-tubulin, Khc and Klc proteins in stai^B200 adults. Surprisingly, ectopic expression of staiB2 not only restored the levels of α-tubulin in stai^B200; tub-staiB2/+ adults as predicted, but also increased the levels of both the Khc and Klc protein subunits (Figure 5C).

Genetic Reductions in the Kinesin Heavy Chain Gene Enhance stai Phenotypes

Because loss of stai function resulted in decreased levels of Khc protein in third instar larvae, and ectopic expression of staiB2 restored reduced levels of conventional kinesin motor protein subunits in adult flies, we assayed for a genetic interaction between stai and kinesin by combining a genetic reduction in the gene that encodes the conventional kinesin heavy chain protein, Khc, with mutations in the stai gene. Loss of a single copy of Khc did not cause a posterior paralysis phenotype or enhance the axonal transport defects observed in stai^B200/+ larvae (data not shown). However, introduction of the Khc²⁰ null allele into the homozygous stai^B200 genetic background increased the penetrance of the posterior paralysis phenotype observed in stai^B200 Khc²⁰/stai^B200 third instar larvae to 97.1% (n=101/104) compared with only 76.7% (n=92/120) of stai^B200 homozygous larvae (Table S1). In addition, we observed a small, but significant, increase in the severity of aberrant accumulation of CSP in the segmental nerve axons of stai^B200 Khc²⁰/stai^B200 compared to stai^B200 third instar larvae (15.89 ± 3.80 CSP accumulations/50 µm segmental nerve axon, n=48, p<0.01, Figure 4E).

Loss of stai Function Alters the Integrity of Axonal MTs

MTs are the main cytoskeletal component of axons. The motor proteins kinesin and cytoplasmic dynein mediate organelle transport on MT tracks within the axon. Given the known function of stai as a regulator of MT dynamics and our demonstration that loss of stai function disrupts axonal transport and reduces the levels of α-tubulin and acetylated α-tubulin in third instar larvae, we assayed the integrity of MTs in segmental nerve axons by immunostaining stai mutant larvae with antibody against the neuronal specific MAP Futsch (mAb 22c10), the Drosophila homolog of the vertebrate MAP1B protein that reveals stabilized MTs in neurons [55].

Wild type larvae have a well-defined MT network in segmental nerve axons, as determined by the even distribution of Futsch protein along the length of individual axons within the compound nerve (Figure 6A). In contrast, the distribution of Futsch protein appeared to be disrupted and less consistent along the length of segmental nerve axons of stai mutant larvae, intense and prominent in some axonal regions (arrows Figure 6B), yet noticeably reduced and absent in other regions of the same axon (small arrowheads Figure 6B). We interpret this observation as a disruption in Futsch-stabilized MTs within stai deficient segmental nerve axons.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 6. Loss of stai Function Reduces Futsch (MAP1B) Protein Levels in Axons and Alters the Integrity of Axonal Microtubules.

(A–F) Confocal micrographs of segmental nerve axons from third instar larvae immunostained with antibody against the MAP Futsch (mAb 22c10). (A) Wild type larvae have well defined Futsch staining in individual axons within segmental nerve bundles. (B) In contrast, loss of stai function results in an inconsistent distribution of Futsch protein along the length of individual axons within segmental nerve bundles. In some regions of an axon, there is prominent Futsch staining (arrows) whereas Futsch staining is noticeably reduced in other areas of the same axon (small arrowheads). In addition, loss of stai function causes gross perturbations in axon morphology (large arrowheads). (C) The perturbations in axon morphology are more profound in segmental nerve axons from stai^B200/Df(2L) Exel6015 larvae. (D) Precise excision of the piggyBac element PBac{5HPw⁺}^B200 reverts the observed phenotypes to wildtype. The reduction in Futsch staining intensity and perturbations in axon morphology observed in stai deficient segmental nerve axons can be ameliorated with the ubiquitous ectopic expression of Drosophila staiB2 (E) or human STMN1 (F). (G) Quantification of average pixel intensity of Futsch immunostained axons of third instar larval segmental nerves. Results are presented in arbitrary units (a.u.) of fluorescence intensity (mean ± S.D.). In panels A-F the scale bar = 10 µm.

https://doi.org/10.1371/journal.pone.0068324.g006

We also observed a dosage dependent reduction in the intensity of Futsch staining in the axons of segmental nerve bundles of stai deficient larvae. We quantified and compared the average pixel intensity of Futsch staining in axons of third instar larvae segmental nerves (Table S4). The axons of stai^B200/+ third instar larvae exhibited a significant reduction in the average pixel intensity of Futsch immunostained segmental nerve axons compared to that observed in wildtype axons (WT 19000 ± 5200 arbitrary units (a.u.), n=43; stai^B200/+ 12600 ± 4800 a.u, n=42, p<0.0001, Figure 6G, Table S4). The average intensity of Futsch staining was further reduced in the axons of stai^B200 homozygous third instar larvae (9000 ± 3000 a.u, n=32 p<0.0001, compare Figure 6A and B) and greater yet in the axons of stai^B200/Df(2L) Exel6015 larvae (7600 ± 2200 a.u, n=30, p<0.0001, compare Figure 6A and C) compared to wildtype.

In addition to acting as tracks to support transport through the axon, MTs also provide internal structural support that influences and maintains the morphology of the axon. Individual axons that comprise the compound segmental nerve of wild type larvae are arranged in linear, ordered bundles (Figure 6A). In contrast, stai deficient larvae exhibited alterations in the morphology of individual axons within the segmental nerve that are not observed in wildtype or stai/+ larvae (large arrowheads Figure 6B). Individual axons were often bent and non-linear in stai deficient segmental nerves. This observed alteration in axon morphology was more pronounced and affects a greater number of segmental nerve axons of stai^B200/Df(2L) Exel6015 larvae (Figure 6C).

We also assessed the integrity of axonal MTs in segmental nerve axons directly by immunostaining stai mutant larvae with antibody against acetylated α-tubulin, indicative of stable microtubules [56]. The axons of stai^B200/+ third instar larvae exhibited a significant reduction in the average pixel intensity of acetylated α-tubulin immunostained segmental nerves compared to the axons of wild type larvae (WT 20600 ± 6800 a.u., n=70; stai^B200/+ 15700 ± 5400, n=110, p<0.0001, Table S5). The average pixel intensity of acetylated α-tubulin staining was reduced further in the axons of stai^B200 larvae (10800 ± 4500 a.u., n=230, p<0.0001, compare Figure 7A and B, Table S5) and even further in stai^B200/Df(2L) Exel6015 axons (9800 ± 2700 a.u., n=125, p<0.05, Figure 7C, Table S5). Thus, loss of stai function results in a reduction in the stabilized microtubule network of peripheral nerve axons in a dosage dependent manner.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 7. Loss of stai Function Reduces Levels of Stabilized Axonal Microtubules.

(A–F) Confocal micrographs of segmental nerve axons from third instar larvae immunostained with antibody against acetylated α-tubulin (mAb 611B1). Axons from (A) wildtype, (B) stai^B200 and (C) stai^B200/Df(2L) Exel6015 larvae. (D) Precise excision of the piggyBac element PBac{5HPw⁺}^B200 reverts the reduction in acetylated α-tubulin back to wild type levels. The reduction in acetylated α-tubulin staining intensity observed in stai deficient segmental nerve axons is significantly restored with the ubiquitous ectopic expression of Drosophila staiB2 (E) or human STMN1 (F). (G) Quantification of average pixel intensity of acetylated α-tubulin immunostained axons of third instar larval segmental nerves. Results are presented in arbitrary units (a.u.) of fluorescence intensity (mean ± S.D.). In panels A-F the scale bar = 10 µm.

https://doi.org/10.1371/journal.pone.0068324.g007

The ubiquitous, exogenous expression of Drosophila staiB2 or human STMN1 rescued the altered morphology of individual axons within segmental nerve bundles of stai^B200 larvae (compare Figure 6C with Figure 6E, F). The rescue transgenes improved, but did not significantly increase, the average pixel intensity of Futsch staining detected in the axons of stai^B200; tub-staiB2/+ (10800 ± 4100 a.u., n=24, p=0.12) and stai^B200; tub-STMN1/+ (10800 ± 1800 a.u., n=22, p=0.14) larvae compared with stai^B200 homozygous larvae (9000 ± 3000 a.u., n=32). However, the rescue transgenes did significantly increase the average pixel intensity of acetylated α-tubulin staining detected in the axons of both stai^B200; tub-staiB2/+ (13400 ± 4500 a.u., n=80, p<0.0001, compare Figure 7A and E) and stai^B200; tub-STMN1/+ (12200 ± 3300, n=115, p<0.05, compare Figure 7A and F) third instar larvae.

Loss of stai Function Alters the Integrity of Muscle MTs

The observed phenotypes following loss of stai function are consistent with a reduction in the level of polymerized MTs in the axons of stai mutant animals, contradictory to the function of stai as a MT depolymerizing protein. Because the integrity of MTs within individual segmental nerve axons is difficult to assess by direct visualization, we also looked at the effect of loss of stai function on the architecture of the MT network in body wall muscle 6 from abdominal segment A4 of our stai mutant larvae.

The MT network in muscle cells from wild type larvae is very well defined, enriched around the nucleus and extending into the cytoplasm (Figure S1 A). The MT network of stai/+ muscle cells appears indistinguishable from wildtype (data not shown). The MT network is noticeably less dense, however, both around the nucleus and within the cytoplasm of muscle cells from stai^B200 mutant larvae (compare Figure S1 A and B). The reduction in polymerized MTs is even more pronounced in stai^B200/Df(2L) Exel6015 larvae (compare Figure S1 A, B and C) confirming that the stai^B200 allele retains residual stai activity. This observation directly supports our results from western blot data regarding the observed reduction in levels of acetylated α-tubulin in stai and stai/Df(2L) Exel6015 third instar larvae. Interestingly, we detect an abundance of fragmented MTs within the cytoplasm of stai deficient cells (arrowheads Figure S1 B, C).

We quantified the density of perinuclear MTs in muscle cells of our stai mutant animals and found that MT density was significantly reduced in stai^B200 (P<0.05) and stai^B200/Df(2L) Exel6015 (P<0.01) larvae (Figure S1 G). The architecture of the MT network was restored to wildtype in stai^excision muscle cells (Figure S1 D) and rescued with expression of both the tub-staiB2 (Figure S1 E), and the human tub-STMN1 transgenes (Figure S1 F). Rescue of the MT network in stai^B200 larvae with the tub-staiB2 transgene resulted in a perinuclear MT density greater than wildtype (P<0.01) (Figure S1 G).